ID: 1147794058_1147794065

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1147794058 1147794065
Species Human (GRCh38) Human (GRCh38)
Location 17:43030218-43030240 17:43030247-43030269
Sequence CCTTCCTGGCTCTGGTCCCACTG TTTCGGTGACATTCTCCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 36, 4: 380} {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!