ID: 1147845137_1147845153

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147845137 1147845153
Species Human (GRCh38) Human (GRCh38)
Location 17:43399477-43399499 17:43399526-43399548
Sequence CCCCTCACGACCCCCCCAGGGAG AAAAAAAAAAAAAAAAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 186} {0: 555, 1: 4817, 2: 41077, 3: 59570, 4: 107201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!