ID: 1147918257_1147918272

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147918257 1147918272
Species Human (GRCh38) Human (GRCh38)
Location 17:43901172-43901194 17:43901205-43901227
Sequence CCTCAAGCCTCAGACGCCTCCCC TTGGTCAGCCACTGGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 322} {0: 1, 1: 0, 2: 1, 3: 24, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!