ID: 1147951077_1147951083

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1147951077 1147951083
Species Human (GRCh38) Human (GRCh38)
Location 17:44108418-44108440 17:44108447-44108469
Sequence CCAGAGAGCAAAGGCTATCCCTA GGTTCTAAAGATGCTGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111} {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!