ID: 1147951403_1147951407

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1147951403 1147951407
Species Human (GRCh38) Human (GRCh38)
Location 17:44109942-44109964 17:44109955-44109977
Sequence CCTGGGAGTGAGGGAAGGAGCGG GAAGGAGCGGCCCAGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 542} {0: 1, 1: 0, 2: 0, 3: 24, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!