ID: 1147970901_1147970909

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1147970901 1147970909
Species Human (GRCh38) Human (GRCh38)
Location 17:44218869-44218891 17:44218888-44218910
Sequence CCCCTCCCGGGCTCCCTTCGCCG GCCGTCCCCGCCCGCACAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 232} {0: 1, 1: 0, 2: 3, 3: 6, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!