ID: 1147978379_1147978387

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1147978379 1147978387
Species Human (GRCh38) Human (GRCh38)
Location 17:44260583-44260605 17:44260597-44260619
Sequence CCCCACAACAATCCTCATCTGCA TCATCTGCAGGGGGTCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 192} {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!