ID: 1148052648_1148052658

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1148052648 1148052658
Species Human (GRCh38) Human (GRCh38)
Location 17:44776705-44776727 17:44776747-44776769
Sequence CCTGGGACTGCTCCGCTCAACCC CCCGCCTAACCTGCACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 129} {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!