ID: 1148052652_1148052663

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1148052652 1148052663
Species Human (GRCh38) Human (GRCh38)
Location 17:44776727-44776749 17:44776774-44776796
Sequence CCACCCCTCTCTCCACAGTGCCC TTACTACTGTGACCATGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 101, 4: 1061} {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!