ID: 1148123819_1148123823

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1148123819 1148123823
Species Human (GRCh38) Human (GRCh38)
Location 17:45226815-45226837 17:45226830-45226852
Sequence CCTTGTCCCAGCTGTGGGGACCC GGGGACCCTTGAACTCTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 545} {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!