ID: 1148128078_1148128088

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1148128078 1148128088
Species Human (GRCh38) Human (GRCh38)
Location 17:45247066-45247088 17:45247102-45247124
Sequence CCTCCTCCGCTGTGGCCCGCCTC CATCCTCCTCTTGGCCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 291} {0: 1, 1: 0, 2: 6, 3: 18, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!