ID: 1148233717_1148233721

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1148233717 1148233721
Species Human (GRCh38) Human (GRCh38)
Location 17:45953278-45953300 17:45953306-45953328
Sequence CCTATTTTCTGCCTATGTCAAGT CTCAAGGATGCTCCTGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 235} {0: 1, 1: 0, 2: 0, 3: 18, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!