ID: 1148238143_1148238160

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1148238143 1148238160
Species Human (GRCh38) Human (GRCh38)
Location 17:45983066-45983088 17:45983110-45983132
Sequence CCAACAGGAGGCCCTCAGGAGCC AGGCGGGGACTGGGCCGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 255} {0: 1, 1: 0, 2: 2, 3: 21, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!