ID: 1148301199_1148301203

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1148301199 1148301203
Species Human (GRCh38) Human (GRCh38)
Location 17:46550305-46550327 17:46550336-46550358
Sequence CCCTCTTTCAAAAAAATAAAAAA CAGCTACTCACCTGGAATACTGG
Strand - +
Off-target summary {0: 6, 1: 62, 2: 2247, 3: 29149, 4: 165052} {0: 2, 1: 4, 2: 2, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!