ID: 1148395001_1148395008

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1148395001 1148395008
Species Human (GRCh38) Human (GRCh38)
Location 17:47300781-47300803 17:47300818-47300840
Sequence CCATCCACCACTTCTGCTTCCCA AGCAAGAGCCTGCAAAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 108, 4: 830} {0: 1, 1: 0, 2: 4, 3: 20, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!