ID: 1148403438_1148403439

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1148403438 1148403439
Species Human (GRCh38) Human (GRCh38)
Location 17:47388031-47388053 17:47388047-47388069
Sequence CCTACAGTGTGGTACTGCTGAAC GCTGAACAGCCACTCTGATTTGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 29, 3: 42, 4: 149} {0: 21, 1: 71, 2: 56, 3: 63, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!