ID: 1148432014_1148432022

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1148432014 1148432022
Species Human (GRCh38) Human (GRCh38)
Location 17:47650187-47650209 17:47650226-47650248
Sequence CCGCCCGAAAGGCCGGGCCGTCG CGCCGCCGCCACCTCCGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42} {0: 1, 1: 0, 2: 22, 3: 218, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!