ID: 1148484143_1148484147

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1148484143 1148484147
Species Human (GRCh38) Human (GRCh38)
Location 17:47979805-47979827 17:47979819-47979841
Sequence CCTCTTTCTGCCCAGAGGCTCCT GAGGCTCCTCCCAGCCTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 387} {0: 1, 1: 0, 2: 2, 3: 30, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!