ID: 1148501775_1148501781

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1148501775 1148501781
Species Human (GRCh38) Human (GRCh38)
Location 17:48097077-48097099 17:48097126-48097148
Sequence CCATCTCTACTAAAAAAATACAA GCCTGTAATTCCAGCTACTTAGG
Strand - +
Off-target summary {0: 2411, 1: 2540, 2: 15396, 3: 234157, 4: 170002} {0: 2083, 1: 44834, 2: 172258, 3: 271952, 4: 451520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!