|
Left Crispr |
Right Crispr |
Crispr ID |
1148501775 |
1148501781 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:48097077-48097099
|
17:48097126-48097148
|
Sequence |
CCATCTCTACTAAAAAAATACAA |
GCCTGTAATTCCAGCTACTTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2411, 1: 2540, 2: 15396, 3: 234157, 4: 170002} |
{0: 2083, 1: 44834, 2: 172258, 3: 271952, 4: 451520} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|