ID: 1148501784_1148501789

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1148501784 1148501789
Species Human (GRCh38) Human (GRCh38)
Location 17:48097136-48097158 17:48097162-48097184
Sequence CCAGCTACTTAGGAGGCCTGAGG GAGAATCACTTGAACCGAGGAGG
Strand - +
Off-target summary {0: 2, 1: 43, 2: 293, 3: 1100, 4: 4462} {0: 107, 1: 23687, 2: 90160, 3: 152121, 4: 170464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!