ID: 1148523752_1148523756

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148523752 1148523756
Species Human (GRCh38) Human (GRCh38)
Location 17:48309399-48309421 17:48309449-48309471
Sequence CCAGTAAGCATGGCCTTGACAAT ATAATATCCTTAACTTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 204} {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!