ID: 1148547418_1148547420

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1148547418 1148547420
Species Human (GRCh38) Human (GRCh38)
Location 17:48528795-48528817 17:48528808-48528830
Sequence CCTGGTTGTGGCTTGCTGGGGGC TGCTGGGGGCAGGCCTTGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 165} {0: 1, 1: 0, 2: 4, 3: 44, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!