ID: 1148554510_1148554515

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1148554510 1148554515
Species Human (GRCh38) Human (GRCh38)
Location 17:48570316-48570338 17:48570345-48570367
Sequence CCATCCAAACTTGACCAGTTACG TAGAATCAGAGTTCTCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 33} {0: 1, 1: 0, 2: 0, 3: 19, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!