ID: 1148603201_1148603213

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1148603201 1148603213
Species Human (GRCh38) Human (GRCh38)
Location 17:48909077-48909099 17:48909102-48909124
Sequence CCGTCTCCATTCCGGCCACCCTC CCACACCTCCCACCTCCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 439} {0: 1, 1: 1, 2: 2, 3: 25, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!