ID: 1148617309_1148617314

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1148617309 1148617314
Species Human (GRCh38) Human (GRCh38)
Location 17:49010781-49010803 17:49010811-49010833
Sequence CCAGGAAAAACTGAGAGTACAGA AGTCCACGCACTAAAATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 302} {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!