ID: 1148617807_1148617817

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1148617807 1148617817
Species Human (GRCh38) Human (GRCh38)
Location 17:49013811-49013833 17:49013836-49013858
Sequence CCCCTCGGGGCCCAGGGCGGGTA CAAGGGCCGCGGGTCCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109} {0: 1, 1: 0, 2: 0, 3: 20, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!