ID: 1148621086_1148621098

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1148621086 1148621098
Species Human (GRCh38) Human (GRCh38)
Location 17:49035478-49035500 17:49035520-49035542
Sequence CCTGGGAGCCTGGGCAGATGCGG GTGGCAGCGGTCTGGGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 324} {0: 1, 1: 0, 2: 2, 3: 38, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!