ID: 1148646690_1148646696

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1148646690 1148646696
Species Human (GRCh38) Human (GRCh38)
Location 17:49223492-49223514 17:49223525-49223547
Sequence CCCGCGAGGGTGACTTTGGTGAA TCTTGCTGCATAGACGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 1, 2: 4, 3: 114, 4: 1622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!