ID: 1148709181_1148709191

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1148709181 1148709191
Species Human (GRCh38) Human (GRCh38)
Location 17:49664671-49664693 17:49664705-49664727
Sequence CCAAAATCTCCCACTTCCTCACC TTGAACCTGGGGCAGGTATCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 497} {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!