ID: 1148715365_1148715371

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1148715365 1148715371
Species Human (GRCh38) Human (GRCh38)
Location 17:49711884-49711906 17:49711899-49711921
Sequence CCTATAATCCCAGCACTTTGGAA CTTTGGAAGGCCAAGGTGGATGG
Strand - +
Off-target summary {0: 1158, 1: 38766, 2: 329426, 3: 249898, 4: 134520} {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!