ID: 1148722278_1148722290

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1148722278 1148722290
Species Human (GRCh38) Human (GRCh38)
Location 17:49762987-49763009 17:49763037-49763059
Sequence CCATGCACTTGACTGTAGCCCTC CCCGGACAAAACAGCCTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122} {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!