ID: 1148740050_1148740061

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1148740050 1148740061
Species Human (GRCh38) Human (GRCh38)
Location 17:49887613-49887635 17:49887642-49887664
Sequence CCACCTGACTTGGCCAGGCCACC TCCCTTTGTGGTAGTGATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 295} {0: 1, 1: 0, 2: 1, 3: 20, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!