ID: 1148824541_1148824550

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1148824541 1148824550
Species Human (GRCh38) Human (GRCh38)
Location 17:50382789-50382811 17:50382828-50382850
Sequence CCCATTTCTCCTCATTCCTTCAG AATGAAGAAGTCCTACAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 636} {0: 2, 1: 0, 2: 2, 3: 29, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!