ID: 1148845509_1148845518

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1148845509 1148845518
Species Human (GRCh38) Human (GRCh38)
Location 17:50527635-50527657 17:50527667-50527689
Sequence CCTTGTTCCTTCTCAGTGAGCAG AAAAGGAGAAGCCAGAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 355} {0: 1, 1: 0, 2: 9, 3: 64, 4: 752}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!