ID: 1148859964_1148859971

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1148859964 1148859971
Species Human (GRCh38) Human (GRCh38)
Location 17:50599658-50599680 17:50599693-50599715
Sequence CCTGGAGCGGGAGGCCAAGAGTT CAGACACACTGCAGGTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174} {0: 1, 1: 0, 2: 0, 3: 30, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!