ID: 1148903365_1148903370

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1148903365 1148903370
Species Human (GRCh38) Human (GRCh38)
Location 17:50895269-50895291 17:50895312-50895334
Sequence CCTGTGTCTCTTCAGGACGCGAG TCTTCGCTTGCCTCCTTACTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!