ID: 1148918503_1148918508

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1148918503 1148918508
Species Human (GRCh38) Human (GRCh38)
Location 17:51005845-51005867 17:51005894-51005916
Sequence CCGTCTCAAAAAAACAGAAAACA TGACAGGCTAACAACTGGAGGGG
Strand - +
Off-target summary {0: 9, 1: 383, 2: 3286, 3: 101539, 4: 86034} {0: 1, 1: 0, 2: 3, 3: 29, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!