ID: 1148929955_1148929970

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1148929955 1148929970
Species Human (GRCh38) Human (GRCh38)
Location 17:51120294-51120316 17:51120325-51120347
Sequence CCCCGCCCCGGCCGCCCCCGGAG CGCGGCCCCCGCCCTGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 723} {0: 1, 1: 1, 2: 1, 3: 53, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!