ID: 1149013291_1149013301

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1149013291 1149013301
Species Human (GRCh38) Human (GRCh38)
Location 17:51880196-51880218 17:51880230-51880252
Sequence CCATAGTTCCCTCCTCCCTTTAT AACCCTGGTATGTCCCCGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 775} {0: 1, 1: 0, 2: 0, 3: 12, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!