ID: 1149038067_1149038080

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1149038067 1149038080
Species Human (GRCh38) Human (GRCh38)
Location 17:52157493-52157515 17:52157545-52157567
Sequence CCTTCACCCTTCTAGGACTGCAC CACACACATTCACACACCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141} {0: 1, 1: 2, 2: 64, 3: 572, 4: 3998}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!