ID: 1149141233_1149141242

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1149141233 1149141242
Species Human (GRCh38) Human (GRCh38)
Location 17:53435705-53435727 17:53435747-53435769
Sequence CCTTGAAAGACAAGAGTCCCCTG CTGTGGTTGTTGAGATGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 161} {0: 1, 1: 0, 2: 0, 3: 37, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!