ID: 1149460210_1149460217

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1149460210 1149460217
Species Human (GRCh38) Human (GRCh38)
Location 17:56822989-56823011 17:56823033-56823055
Sequence CCAAGGTCAGCATCATGTTCCTG TCCAACTTAAACAGGGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205} {0: 1, 1: 0, 2: 1, 3: 32, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!