ID: 1149518960_1149518966

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1149518960 1149518966
Species Human (GRCh38) Human (GRCh38)
Location 17:57303940-57303962 17:57303958-57303980
Sequence CCTCAAGCATGGGAGGACCTGAA CTGAATTACTAGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167} {0: 1, 1: 0, 2: 8, 3: 111, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!