ID: 1149523764_1149523772

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1149523764 1149523772
Species Human (GRCh38) Human (GRCh38)
Location 17:57338542-57338564 17:57338565-57338587
Sequence CCCCACGCAGACTTGTTGCATCC CAGTTGCTTGGGGACCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78} {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!