ID: 1149542125_1149542132

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1149542125 1149542132
Species Human (GRCh38) Human (GRCh38)
Location 17:57475358-57475380 17:57475398-57475420
Sequence CCCCAAGGACACATGCGTGCACA AAGCCCAAGTGGCATCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 67, 4: 418} {0: 1, 1: 0, 2: 1, 3: 45, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!