ID: 1149544600_1149544601

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1149544600 1149544601
Species Human (GRCh38) Human (GRCh38)
Location 17:57494025-57494047 17:57494039-57494061
Sequence CCTCTGGTCACTCTCTACATAGC CTACATAGCAGAAGCTCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132} {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!