ID: 1149570766_1149570771

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1149570766 1149570771
Species Human (GRCh38) Human (GRCh38)
Location 17:57670768-57670790 17:57670808-57670830
Sequence CCTAAATCTGCATGTGGTACCTG TACATAACTATTTCAGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 150} {0: 1, 1: 0, 2: 3, 3: 28, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!