ID: 1149651589_1149651600

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1149651589 1149651600
Species Human (GRCh38) Human (GRCh38)
Location 17:58279479-58279501 17:58279519-58279541
Sequence CCTCTCTGAGCCCGGTTCCTGCA GCACCTGTTGTTGCACATCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 276} {0: 1, 1: 0, 2: 0, 3: 16, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!