ID: 1149679297_1149679303

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149679297 1149679303
Species Human (GRCh38) Human (GRCh38)
Location 17:58493990-58494012 17:58494025-58494047
Sequence CCAATCTGGGTCTCAACTGCCTC CACTGTTGGGCCGGGCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 520} {0: 3, 1: 7, 2: 85, 3: 681, 4: 3889}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!