ID: 1149724259_1149724264

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1149724259 1149724264
Species Human (GRCh38) Human (GRCh38)
Location 17:58877217-58877239 17:58877261-58877283
Sequence CCAACATAGGTAGCCTTGGTACC TTTCCTCATTGTTAATGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 1, 3: 56, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!